分子生物学分子生物学 (4).pdf

Chapter 2Genes and Genomes2.2.1 The concept of genomesGenomeGenome:GeneGenet ticic termterm forfor a a completecomplete setset ofof haploidhaploidgeneticgenetic materialmaterial inin a a cellcell oror organismorganism.2.2 Prokaryotic genomeC-value:the amount of total DNA in the haploid genome(bp)The genome size and structure of different organisms vary greatlyKilobasepairs/chromosomeLength(cm)Number ofchromosomes(haploid)shapevirusvirusSV405.20.000171Circular double strandBacteriophage X1745.40.000181Circular single chainBacteriophage 480.00151Linear double strandProkaryotesE.coli46000.131Circular double strandEukaryoteyeast10000.03317Linear double strandDrosophila410001.44Linear double strandhuman1250004.123Linear double strand2.2.2 Structural features of the prokaryotic genomeEscherichia coliEscherichia coliNucleoidNucleoid:DNADNAofofbacterialbacterialchromosomeschromosomesgathersgathers toto formform a a densedense areaarea.a a.ItIt consistsconsists ofof a a circularcircular doubledouble-strandedstranded DNADNAmolecule,molecule,b b.ThereThereisisusuallyusuallyonlyonlyoneoneDNADNAreplicationreplicationoriginorigin.c c.The coding sequence generally does not overlap;.The coding sequence generally does not overlap;d d.The coding area is larger than the non.The coding area is larger than the non-coding area;coding area;e e.There are few repeating sequences,and most of the.There are few repeating sequences,and most of the structural genes are single copies;structural genes are single copies;f f.A homologous gene that encodes an isoenzyme(isogene).A homologous gene that encodes an isoenzyme(isogene).g g.There is a mobile DNA sequence.There is a mobile DNA sequenceBarbara McClintock 1902-1992transposition：TranslocationTranslocationfactorsfactorsmovemovebetweenbetween differentdifferent locationslocations ininthethe genomegenome.transposable element：A ApiecepieceofofDNADNAthatthatcancanmovemovewithinwithin a a DNADNA moleculemolecule oror betweenbetween twotwoDNADNA moleculesmolecules.transposontransposon（TnTn）(1)Types of transposition factors(1)Types of transposition factors insertion insertion sequencesequence（IsIs）Transposable bacteriophageTransposable bacteriophageTransposaseTransposaseAmpicillin resistanceTransposase binding siteTransposaseHead and tail proteinTransposase binding siteHost DNAMu bacteriophageHost DNA(2)Mechanism of transposition(2)Mechanism of transpositionDonor DNADonor DNATransposonTransposonReceptor DNAReceptor DNACopy and Copy and transposetransposeNew DNANew DNACut and Cut and connectconnectDonor DNADonor DNATransposonTransposonReceptor DNAReceptor DNANew DNANew DNAReplicative transposition is when a new copy of the transposable element Replicative transposition is when a new copy of the transposable element is transferred to a new location in the genome.Simple transposition is is transferred to a new location in the genome.Simple transposition is when the transposable element is removed from its original position and when the transposable element is removed from its original position and transferred to a new position in the genome.transferred to a new position in the genome.11Replicative transposition canfusedonorandacceptorreplicons to form a co-integrator,which releases two repliconsafter dissociation,each with atransposon.TransposonFusionReplicon 1Replicon 2CointegratorReorganizationDissociationTransposonTransposonF FE EA AB BC CD DcopycopyinsertinsertNew copy of New copy of transposontransposonF FE EA AB BC CD DInserInsert newt new mutationmutationOr introduce new genesOr introduce new genesReplication start area(OriC)250 bpReplication start area(OriC)250 bph h.With multi.With multi-functional identification areafunctional identification areaReplication start region,replication termination region,transcription initiation region,transcription termination regionGACCGCCGCUGGCGGC A U U U U 35U U CGG 5GCCGCCAGUUCGGCUGGCGGCAUUUU3RNA5GCCGCCAGTTCGGCTGGCGGCATTTT 3DNATranscription termination regionTranscription termination region The genome consists of a circular double-stranded DNA;There is only one origin of replication;with operon structure;The coding sequences generally do not overlap;The coding area is larger than the non-coding area;There are few repeating sequences,and the structural gene is generally a single copy;Has the same gene encoding the isozyme;There is a mobile DNA sequence;Recognition area with multiple functions.So much for this online class,thank you!The following is a summary of the structural characteristics of prokaryotic genomes:Thank You