Effects of medium- and long-chain fatty acids.pdf

Food Sci Nutr. 2020;00112. | 1www.foodscience- 1|INTRODUCTION The liver is a vital organ of mammals and primarily responsi- ble not only for maintaining nutrient homeostasis by regulating protein, carbohydrate, and fat metabolism, but also rting de- toxification by decomposing and transing various drugs and toxins, and excreting certain metabolites in the body. Therefore, when some drugs were taken overdose, they may overwhelm the Received 7 February 2020| Revised 20 April 2020| Accepted 24 April 2020 DOI 10.1002/fsn3.1641 O R I G I N A L R E S E A R C H Effects of medium- and long-chain fatty acids on acetaminophen- or rifampicin-induced hepatocellular injury Jun Yang1,2,3| Ting Peng1,2,3| Jiyong Huang1,2,4| Guohua Zhang1,2,3| Jiaheng Xia1,2,4| Maomao Ma1,2,3| Danwen Deng1,2| Deming Gong1,2,5| Zheling Zeng1,2,4 This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. 2020 The Authors. Food Science Funding ination International Science and Technology Cooperation Program of China, Grant/Award Number 2011DFA32770; Research Program of State Key Laboratory of Food Science and Technology, Nanchang University, Grant/ Award Number SKLF-ZZB-201517 and SKLF-ZZA-201610; Science and Technology Program of Jiangxi Province, Grant/Award Number 20143ACG70015; National Natural Science Foundation of China, Grant/Award Number 31701651 Abstract Drug-induced liver injury DILI is one of the common adverse effects of drug ther- apy, which is closely associated with oxidative stress, apoptosis, and inflammation response. Medium-chain fatty acids MCFA were reported to relieve inflammation and attenuate oxidative stress. However, little has been known about the hepato- protective effects of MCFA in DILI. In the present study, acetaminophen AP and rifampicin RFP were used to establish DILI models in LO2 cells, and the cytoprotec- tive effects of MCFA on hepatocellular injury were investigated. Results showed that the optimal condition for the DILI model was treatment with 10 mM AP or 600 M RFP for 24 hr. LCFA treatment markedly reduced the cell viability and increased the activities of alanine aminotransferase, aspartate aminotransferase, and lactate de- hydrogenase. Meanwhile, LCFA treatment aggravated cell apoptosis, mitochondrial dysfunction, and oxidative stress. The mRNA and protein expression levels of inflam- matory cytokines IL-1 and TNF- were significantly elevated by LCFA. In contrast, MCFA treatment did not significantly affect cell viability, apoptosis, oxidative, stress and inflammation, and it did not produce the detrimental effects on DILI models. Therefore, we proposed that MCFA may be more safe and suitable than LCFA as nu- trition support or the selection of daily dietary oil and fat for the patients with DILI. K E Y W O R D S apoptosis, drug-induced liver injury, inflammatory cytokines, long-chain fatty acids, medium- chain fatty acids, oxidative stress 2 | YANG et Al. liver self-detoxification capacity, leading to liver injury Bernal, Lee, Wendon, Larsen, Zuquan, Kejian, Haibo, Jing et al., 2015; Macaire et al., 2013; Sivakanthan, Jayasooriya, then, the cell viability was determined using MTT assay. In another set of experiments, cells were seeded into 24-well plates at a density of 5 104 cells per well. After treated as above, plates were incubated at 37C for 24 hr. Then, the media were collected to measure the activities of AST and ALT using activity determination kits, according to the manufacturers instructions. Then, the apop- totic cells were measured by double staining with Hoechst 33342/ PI assay. Briefly, the treated cells were washed three times with cold PBS and stained with Hoechst 33342/PI at 4C for 20 min in the dark, then washed twice with cold PBS and observed under a fluorescence microscope. AST and ALT assay, and apoptosis observation were con- ducted as confirmation experiments to support the MTT assay. 2.3|Measurement of cell viability Fatty acid including octanoic acid, decanoic acid, lauric acid, and oleic acid were dissolved in PBS to the stock solution at 8 mM and diluted by the serum-free medium. For the viability assay, LO2 cells were seeded into 96-well plates at a density of 1 104 cells per | 3YANG et Al. well and cultured overnight. Then, the cells were treated with dif- ferent concentrations of FA 0, 50, 100, 200, 400, and 800 M for 24 hr. For further studies, LO2 cells were also treated with 20 mM AP and 600 M RFP for 24 hr and then incubated with 200 M FA for an additional 24 hr. Then, 10 l of MTT solution was added to each well and incubated for 4 hr at 37C. Next, the supernatant was carefully removed, the purple azan crystals were dissolved in 150 l DMSO, and the absorbance value at 490 nm was measured by a SpectraMax absorbance reader Molecular Devices. 2.4|Lactate dehydrogenase LDH assay Lactate dehydrogenase assay was conducted as a confirmation experi- ment to support the MTT assay. The level of LDH released from injured or dead cells was measured as an indicator of cytotoxicity. The LO2 cells were seeded at 1 104 cells/well onto a 96-well plate for 12 hr and treated as the procedure for MTT assay. The supernatant was col- lected to measure the activity of LDH using an activity determination kit, according to the manufacturers instructions. The absorbance at 450 nm was then determined by a SpectraMax absorbance reader. 2.5|Apoptosis assay LO2 cells were seeded at a density of 1 106 cells per well onto 6-well plates and cultured overnight. Then, the wells were divided into the following groups The cells were treated with 20 mM AP or 600 M RFP for 24 hr and then incubated with 200 M octanoic acid C80 group, decanoic acid C100 group, lauric acid C120 group, and oleic acid C181 group for an additional 24 hr, the cells treated with 20 mM AP or 600 M RFP for 24 hr and then incu- bated with serum-free medium containing PBS or 0.1 DMSO for an additional 24 hr naturally restoring group, NR group, and the cells treated with serum-free medium normal control group, NC group. After the treated cells were rinsed three times with cold PBS and harvested by trypsinization, they were washed twice with cold PBS followed by centrifugation at 112 g for 10 min. Then, the cell pellet was resuspended in 500 l binding buffer followed by incubation with Annexin V-FITC 5 l and PI 5 l for 15 min at room tem- perature in the dark. The excitation wavelength was 488 nm, and the emission wavelength was 525 nm. A flow cytometer with BD Accuri C6 software FCM, Becton-Dickinson was used to determine the apoptosis rate after acquiring 10,000 cells. Furthermore, apoptotic hepatocytes were identified by morphology, after the treated cells were washed three times with cold PBS and stained with Hoechst 33342/PI at 4C for 20 min in the dark, then washed twice with cold PBS and observed under a fluorescence microscope. 2.6|Measurement of mitochondrial membrane potential MMP The treated cells were uated for the change in MMP using Rhodamine 123 Rh-123 cationic dye and a flow cytometer. Briefly, the cells were harvested and resuspended in complete RPMI 1640 media with 10 FBS containing Rh-123 5 g/ml and kept at 37C for 30 min. Next, the cells were washed twice with PBS, followed by centrifugation at 447 g for 5 min to remove the unreacted Rh- 123 dye. Finally, the cell pellet was resuspended in 500 l PBS and detected by flow cytometry. Ten thousand cells were acquired and analyzed by BD Accuri C6 software. 2.7|Determination of intracellular antioxidant inds Intracellular antioxidant inds, including total antioxidant ca- pacity T-AOC, levels of malondialdehyde MDA, and glutathione GSH, and activities of superoxide dismutase SOD and catalase CAT were determined with assay kits according to the instruc- tions of the manufacturers. Briefly, the cells were harvested and incubated in a chilled cell lysis buffer for 30 min. The cells were centrifuged at 16,099 g for 10 min at 4C, and the supernatant was collected to measure antioxidant inds. Total protein content in the supernatant was determined by BCA protein assay kit Beyotime Biotechnology, using bovine serum albumin as a standard. All assays were conducted at least in six replicates, and values given are aver- age of these replicates. 2.8|Quantitative real-time polymerase chain reaction q-PCR The expression levels of the IL-1, IL-6, IL-8, MCP-1, and TNF- mRNAs were analyzed by q-PCR. The total RNA was isolated from a cell sample CytokinesForward 53Reverse 53 IL-1ATGATGGCTTATTACAGTGGCAAGTCGGAGATTCGTAGCTGGA IL-6CCTGAACCTTCCAAAGATGGCTTCACCAGGCAAGTCTCCTCA IL-8ACTGAGAGTGATTGAGAGTGGACAACCCTCTGCACCCAGTTTTC MCP-1CAGCCAGATGCAATCAATGCCTGGAATCCTGAACCCACTTCT TNF-CCTCTCTCTAATCAGCCCTCTGGAGGACCTGGGAGTAGATGAG GAPDHCAATGACCCCTTCATTGACCGACAAGCTTCCCGTTCTCAG TABLE 1The sequences of primers used for quantitative real-time PCR analysis 4 | YANG et Al. using TRIzol Reagent CWBIO according to the manufacturers proto- col. Reverse transcription was conducted using a Quantscript RT Kit Tiangen Biotech Co. PCR was carried out in a total volume of 10 l using an SYBR Premix Kit Takara Bio Inc. on a 7900 HT Fast Real-Time PCR System Applied Biosystems with the following program 95C for 30 s, followed by 40 cycles of 5 s at 95C and 30 s at 60C. The prim- ers Table 1 were designed using Primer Express and synthesized by Sangon Biotech. GADPH was used as a housekeeping gene to normal- ize the expression levels of the target genes. The relative expression ratio of the mRNA was calculated by the comparative critical threshold . Data are expressed as a fold change relative to the NC group. 2.9|Western blot analyses The cells were lysed in RIPA buffer Beyotime Biotechnology with a protease inhibitor PMSF Beyotime Biotechnology and centrifuged at 16,099 g for 10 min at 4C to obtain the supernatant. Cellular total protein concentration was quantified by BCA protein assay kit according to the manufacturers protocol. Equal amounts of protein 20 g per lane were separated by 12 SDS-PAGE and transferred onto PVDF membranes 0.22 m, Millipore. After blocking with Tris-buffered saline Tween-20 TBST containing 5 skimmed milk powder for 2 hr at room temperature, the membranes were incu- bated with different primary antibodies anti-IL-1 14,000, mouse monoclonal antibody, anti-TNF- 11,500, mouse monoclonal antibody, and anti--actin 12,000, rabbit polyclonal antibody at 4C overnight. Then, the cells were incubated with secondary HRP- conjugated goat anti-rabbit/mouse IgG 13,000 for 2 hr at room temperature after washed by TBST three times. At last, the protein bands on the membranes were visualized with the enhanced ECL detection system Bio-Rad after washed by TBST three times. Protein bands were quantitatively analyzed using AlphaEaseFC soft- ware and normalized to -actin. 2.10|Statistical analysis Statistical Package for the Social Sciences 19.0 software SPSS, Inc. was used to process all data. Data were presented as the mean standard deviation SD. The differences between groups were analyzed by one-way analysis of variance ANOVA, followed by the independent t test. Values at p .05 and p .01 were consid- ered to be statistically significant and very significant. 3|RESULTS 3.1|Cell viabilities, activities of ALT and AST, and apoptosis in AP- or RFP-treated LO2 cells LO2 cells were used to establish a hepatocyte injury model by AP or RFP treatment. To determine the optimal damage conditions, LO2 cells were treated with different concentrations of AP or RFP for 24, 48, and 72 hr, and the cell viability was determined by MTT assay. As shown in Figure 1a,b, with the increases in the concentration of AP or RFP and treatment time, the survival rates of LO2 cells decreased gradually in a dose- and time-dependent manner. Cell viability was significantly decreased in the AP-treated group from 10 to 20 mM for 24 hr and the RFP-treated group from 400 to 800 M for 24 hr compared to the control group p .01. The results also showed that the half-maximal inhibitory concentrations IC50 of AP and RFP FIGURE 1Cytotoxicity of AP and RFP on LO2 cells. The proliferation activities of LO2 cells treated with different concentrations of AP a, 5, 10, 15, and 20 mM and RFP b, 200, 400, 600, and 800 M for 24, 48, and 72 hr. The activities of ALT and AST in the supernatant in LO2 cells treated with different concentrations of AP c, 0, 5, 10, 15, and 20 mM and RFP d, 0, 200, 400, 600, and 800 M for 24 hr. Apoptotic cells were observed under a fluorescence microscope with Hoechst 33342/PI costaining assay, after treatment with AP e, 020 mM and RFP f, 0800 M for 24 hr. Data represent the means SD n 6. *p .05, **p .01 compared with the NC group | 5YANG et Al. in LO2 cells treated for 24, 48, and 72 hr were 13.15, 7.439, and 3.543 mM and 696.5, 298.2, and 164.1 M, respectively. To further uate the hepatic injury effects of AP or RFP on LO2 cells for 24 hr, ALT and AST assay and Hoechst 33342/PI assay were conducted. The results showed that compared to the control group, the activities of both ALT and AST significantly increased in a concentration-dependent manner when the concentrations of AP and RFP were higher than 5 mM and 200 M, respectively p .01, Figure 1c,d. Additionally, the results from fluorescence microscopy showed that treatments with 1020 mM of AP or 400800 M of RFP evoked a marked increase in the number of apoptotic cells in drug-induced hepatocellular injury, whereas treatment with 5 mM of AP or 200 M of RFP remained unchanged or increased slightly compared with the control group Figure 1e,f. These results showed that LO2 cells can be used as an in vitro model for drug-induced hep- atotoxicity, and the optimal concentration on the cells was 10 mM of AP or 600 M of RFP for 24 hr. 3.2|Effects of FA on the cell viability and toxicity of LO2 cells and AP- or RFP-treated LO2 cells The MTT and LDH assay were pered to determine the effect of FA on cytotoxicity of LO2 cells and hepatoprotection of AP- or RFP-damaged cell model AP or RFP model. As shown in Figure 2a, the proliferation of LO2 cells was reduced when the concentrations of FA were higher than 200 M. Especially, lauric acid and oleic acid at concentrations higher than 200 M induced significant cytotoxic responses compared with the control group p .01. In addition, AP or RFP model treated with 200 M of MCFA showed cell via- bility similar to the NR group, whereas treatment with 200 M of oleic acid showed a significant decrease in the cell viability p .01, compared with the NR g